1887

Chapter 87 : Filoviruses and Arenaviruses

MyBook is a cheap paperback edition of the original book and will be sold at uniform, low price.

Preview this chapter:
Zoom in
Zoomout

Filoviruses and Arenaviruses, Page 1 of 2

| /docserver/preview/fulltext/10.1128/9781555815905/9781555813642_Chap87-1.gif /docserver/preview/fulltext/10.1128/9781555815905/9781555813642_Chap87-2.gif

Abstract:

The need for sensitive, specific viral diagnostics and for having procedures in place to handle such agents is essential for the correct identification and containment of outbreaks of viral hemorrhagic fevers (VHFs). Since the procedures for initial isolation, clinical management, and virologic diagnoses of patients with suspected arenavirus and filovirus infections are similar, these taxonomically distinct viruses are discussed together in this chapter. All arenaviruses are maintained in nature by establishing chronic viremia in their reservoir host (almost exclusively rodents) and are transmitted to humans through contaminated animal excreta or occasionally bites. Personto-person transmission (secondary infection) also occurs with Lassa virus (LAS) and less frequently with the South American VHF-causing arenaviruses. Laboratory diagnosis can be achieved in two ways, measurement of host-specific immune responses to the infection and detection of viral antigen and/or genomic RNA. Because of the presence of high titers of infectious virus in blood and tissues even during early stages, antigen and nucleic acid detection plays the most important role in early detection of VHF infections caused by arenaviruses and filoviruses. The method of choice for isolation of pathogenic filoviruses and arenaviruses is the inoculation of appropriate cell cultures, usually Vero cells (especially clone E6), MA-104 cells, or SW-13 cells, followed by examination of inoculated cells at intervals for the presence of viral antigens by using an immunological staining method such as direct immunofluorescence assay (DFA) or immunoperoxidase assays.

Citation: Strong J, Grolla A, Jahrling P, Feldmann H. 2006. Filoviruses and Arenaviruses, p 774-790. In Detrick B, Hamilton R, Folds J (ed), Manual of Molecular and Clinical Laboratory Immunology, 7th Edition. ASM Press, Washington, DC. doi: 10.1128/9781555815905.ch87

Key Concept Ranking

Clinical and Public Health
1.1288003
Lymphocytic choriomeningitis virus
0.5443942
Indirect Immunofluorescence Assay
0.4752727
Enzyme-Linked Immunosorbent Assay
0.4642198
1.1288003
Highlighted Text: Show | Hide
Loading full text...

Full text loading...

Figures

Image of FIGURE 1
FIGURE 1

Morphology of virus particles. (A) Arenaviruses. Arenaviruses are round to pleomor-phic enveloped particles with a bisegmented, single-stranded, negative-sense RNA genome. Two proteins are involved in nucleocapsid formation: RNA-dependent RNA polymerase (L) and nucle-oprotein (NP). The glycoproteins (GP-1 and GP-2) form the spikes on the virion surface. The Z protein functions as the matrix protein. Ribosomes are usually incorporated during particle maturation. (B) Filoviruses. Filoviruses are filamentous enveloped particles with a nonsegmented, single-stranded, negative-sense RNA genome. Four proteins are involved in nucleocapsid formation: RNA-dependent RNA polymerase (L), nucleoprotein (NP), virion structural protein 30 (VP30), and VP35. The glycoprotein (GP) forms the spikes on the virion surface (arrows in electron micrograph). VP40 functions as the matrix protein; VP24 is membrane associated.

Citation: Strong J, Grolla A, Jahrling P, Feldmann H. 2006. Filoviruses and Arenaviruses, p 774-790. In Detrick B, Hamilton R, Folds J (ed), Manual of Molecular and Clinical Laboratory Immunology, 7th Edition. ASM Press, Washington, DC. doi: 10.1128/9781555815905.ch87
Permissions and Reprints Request Permissions
Download as Powerpoint
Image of FIGURE 2
FIGURE 2

Filovirus outbreaks in Central Africa. Reported outbreaks of HF caused by MARV (dark gray) and EBOV (light gray) in the affected countries are indicated with the corresponding year, case numbers, and percentage lethality. DRC, Democratic Republic of the Congo; ICEBOV, Ivory Coast ebolavirus; RC, Republic of the Congo; SEBOV, Sudan ebolavirus; ZEBOV, Zaire ebolavirus.

Citation: Strong J, Grolla A, Jahrling P, Feldmann H. 2006. Filoviruses and Arenaviruses, p 774-790. In Detrick B, Hamilton R, Folds J (ed), Manual of Molecular and Clinical Laboratory Immunology, 7th Edition. ASM Press, Washington, DC. doi: 10.1128/9781555815905.ch87
Permissions and Reprints Request Permissions
Download as Powerpoint
Image of FIGURE 3
FIGURE 3

Time line for diagnostic sampling. The scheme demonstrates an approximate time line for sampling and testing of EBOV-infected patients. The numbers indicate days after onset of symptoms.

Citation: Strong J, Grolla A, Jahrling P, Feldmann H. 2006. Filoviruses and Arenaviruses, p 774-790. In Detrick B, Hamilton R, Folds J (ed), Manual of Molecular and Clinical Laboratory Immunology, 7th Edition. ASM Press, Washington, DC. doi: 10.1128/9781555815905.ch87
Permissions and Reprints Request Permissions
Download as Powerpoint
Image of FIGURE 4
FIGURE 4

Diagnostic flowchart. For further information, see the text.

Citation: Strong J, Grolla A, Jahrling P, Feldmann H. 2006. Filoviruses and Arenaviruses, p 774-790. In Detrick B, Hamilton R, Folds J (ed), Manual of Molecular and Clinical Laboratory Immunology, 7th Edition. ASM Press, Washington, DC. doi: 10.1128/9781555815905.ch87
Permissions and Reprints Request Permissions
Download as Powerpoint
Image of FIGURE 5
FIGURE 5

Real-time RT-PCR detection of filoviruses. (A) Amplification curves and melting point analysis of (ZEBOV) (long dash, D-1), (SEBOV) (dash, D-2), (ICEBOV) (solid, D-3), (MARV) strain Musoke (dash dot, D-4), MARV strain Ravin (long dash dot, D-5), MARV strain Ozolin (long dash dot dot, D-6), and a control (round dot, D-7). (B and C) Separate amplification curves and melting point analyses for the EBOV species (ZEBOV, SEBOV, and ICEBOV) and MARV strains, respectively. (D) Agarose gel electrophoresis of the amplification products of the real-time filovirus RT-PCR with a 100-bp DNA ladder. Viral RNA was extracted from tissue culture supernatants by using a Qiagen viral RNA kit followed by real-time RT-PCR with a Lightcycler RNA SYBR Green I kit with 0.2 μM each primer and cycling parameters of RT reaction at 50°C for 20 min, denaturation at 94°C for 120 s, and amplification of 40 cycles at 95°C for 15 s, 50°C for 30 s, and 72°C for 30 s. Primers target the EBOV (EVSP5 [5′ ACATCTTTCTTTCTTTG GGTAAT] and EVSP3 [5′ CAGT TCTCAGC-CCATTCACCAGCTT]) and MARV (MVSP5 [5′AAAGTTGCTGAT TCCCCTTTGGA] and MVSP3 [5′ GCATGAGG GTTTTGACCTTGAAT]) glycoprotein genes and produce 273- and 223-bp amplification products, respectively. Melting-point analysis was done by heating the amplification products from 60 to 95°C at 0.2°C/s while monitoring the samples for loss of fluorescence, indicating the point at which double-stranded DNA melts and the intercalating dye loses fluorescence. The first derivative of the melting curve is shown here for ease of interpretation. The presence of peaks at appropriate melting temperatures distinguishes authentic product from nonspecific products and primer-dimers as seen for the control (round dot).

Citation: Strong J, Grolla A, Jahrling P, Feldmann H. 2006. Filoviruses and Arenaviruses, p 774-790. In Detrick B, Hamilton R, Folds J (ed), Manual of Molecular and Clinical Laboratory Immunology, 7th Edition. ASM Press, Washington, DC. doi: 10.1128/9781555815905.ch87
Permissions and Reprints Request Permissions
Download as Powerpoint
Image of FIGURE 6
FIGURE 6

Real-time RT-PCR detection of arenaviruses. (A) Amplification curves and melting-point analysis of Machupo (MAC) (dash, D-1), Junin (JUN) (square dot, D-2), Sabia (SAB) (dash dot, D-3), Guanarito (GTO) (long dash dot dot, D-4), Lassa (LAS), strain Josiah (solid, D-5), LAS strain Pinneo (long dash, D-6), virus (LCMV) (long dash dot, D-7), and a control (round dot, D-8). (B and C) Separate amplification curves and melting point analysis for the New World complex species (MAC, JUN, GTO, and SAB) and the Old World complex species (LAS and LCMV), respectively. (D) Agarose gel electrophoresis of the amplification products of the arenavirus real-time RT-PCR with a 100-bp DNA ladder. RNA was extracted from tissue culture supernatants by using a Qiagen viral RNA kit followed by real-time RT-PCR with a Lightcycler RNA SYBR Green I kit with 0.2 μM each primer and cycling parameters of RT reaction at 50°C for 20 min, denaturation at 94°C for 120 s, and amplification of 40 cycles at 95°C for 15 s, 50°C for 30 s, and 72°C for 30 s. Primers target the NP gene for New World arenaviruses (NWA5 [5′ TTTGAAGC-CTTTCTCATCATG] and NWA3 [5′ TGGCCTTACATTGGTTC(CA)AG(AG)TC]) and the GPC gene of the Old World arenaviruses (OWA5 [5′ ACCGGGGATCCTAGGCATTT] and OWA3 [5′ ATATAATGATGACTGTTGTTCTTTGTCA]) and produce amplification products of 288 and ˜250 to 345 bp, respectively. Melting-point analysis was achieved by heating the amplification products from 60 to 95°C at 0.2°C/s while monitoring the samples for loss of fluorescence, indicating the point at which double-stranded DNA melts and the intercalating dye loses fluorescence. The first derivative of the melting curve is shown here for ease of interpretation. The presence of peaks at appropriate melting temperatures distinguishes authentic product from nonspecific products and primer-dimers as seen for the mock infection (round dots).

Citation: Strong J, Grolla A, Jahrling P, Feldmann H. 2006. Filoviruses and Arenaviruses, p 774-790. In Detrick B, Hamilton R, Folds J (ed), Manual of Molecular and Clinical Laboratory Immunology, 7th Edition. ASM Press, Washington, DC. doi: 10.1128/9781555815905.ch87
Permissions and Reprints Request Permissions
Download as Powerpoint

References

/content/book/10.1128/9781555815905.ch87
1. Barber, G. N.,, J. C. Clegg, and , J. Chamberlain. 1987. Expression of Lassa virus nucleocapsid protein segments in bacteria: purification of high-level expression products and their application in antibody detection. Gene 56:137144.
2. Barber, G. N.,, J. C. Clegg, and , G. Lloyd. 1990. Expression of the Lassa virus nucleocapsid protein in insect cells infected with a recombinant baculovirus: application to diagnostic assays for Lassa virus infection. J. Gen. Virol. 71:1928.
3. Bausch, D. G.,, P. E. Rollin,, A. H. Demby,, M. Coulibaly,, J. Kanu,, A. S. Conteh,, K. D. Wagoner,, L. K. McMullan,, M. D. Bowen,, C. J. Peters, and , T. G. Ksiazek. 2000. Diagnosis and clinical virology of Lassa fever as evaluated by enzyme-linked immunosorbent assay, indirect fluorescent-antibody test, and virus isolation. J. Clin. Microbiol. 38:26702677.
4. Borio, L.,, T. Inglesby,, C. J. Peters,, A. L. Schmaljohn,, J. M. Hughes,, P. B. Jahrling,, T. Ksiazek,, K. M. Johnson,, A. Meyerhoff,, T. O’Toole,, M. S. Ascher,, J. Bartlett,, J. G. Breman,, E. M. Eitzen, Jr.,, M. Hamburg,, J. Hauer,, D. A. Henderson,, R. T. Johnson,, G. Kwik,, M. Layton,, S. Lillibridge,, G. J. Nabel,, M. T. Osterholm,, T. M. Perl,, P. Russell,, K. Tonat, and the Working Group on Civilian Biodefense. 2002. Hemorrhagic fever viruses as biological weapons: medical and public health management. JAMA 287:23912405.
5. Buchmeier, M. J.,, M. D. Bowen, and , C. J. Peters. 2001. Arenaviridae: the viruses and their replication, p. 16351668. In B. N. Fields and , D. M. Knipe (ed.), Virology, 4th ed. Raven Press, Philidelphia, Pa.
6. Charrel, R. N., and , X. de Lamballerie. 2003. Arenaviruses other than Lassa virus. Antiviral Res. 57:89100.
7. Drosten, C.,, S. Göttig,, S. Schilling,, M. Asper,, M. Panning,, H. Schmitz, and , S. Gilnther. 2002. Rapid detection and quantification of RNA of Ebola and Marburg viruses, Lassa virus, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, Dengue virus, and yellow fever virus by real-time reverse transcription-PCR. J. Clin. Microbiol. 40:23232330.
8. Feldmann, H.,, S. Jones,, H. D. Klenk, and , H. J. Schnittler. 2003. Ebola virus: from discovery to vaccine. Nat. Rev. Immunol. 3:677685.
9. Feldmann, H.,, T. W. Geisbert,, P. B. Jahrling,, H. D. Klenk,, S. V. Netesov,, C. J. Peters,, A. Sanchez,, R. Swanepoel, and , V. E. Volchkov. 2004. Filoviridae, p. 645653. In C. M. Fauquet,, M. A. Mayo,, J. Maniloff, U. Desselberger, and , L. A. Ball (ed.), Virus Taxonomy, VIIIth Report of the ICTV Elsevier/Academic Press, London, United Kingdom.
10. Feldmann, H.,, V. Wahl-Jensen,, S. M. Jones, and , U. Stroeher. 2004. Ebola virus ecology: a continuing mystery. Trends Microbiol. 12:433437.
11. Garcia Franco, S.,, A. M. Ambrosio,, M. R. Feuillade, and , J. I. Maiztegui. 1988. Evaluation of an enzyme-linked immunosorbent assay for quantitation of antibodies to Junin virus in human sera. J. Virol. Methods 19:299305.
12. Geisbert, T. W., and , P. B. Jahrling. 1995. Differentiation of filoviruses by electron microscopy. Virus Res. 39:129150.
13. Geisbert, T. W, and , R. B. Jahrling. 2004. Exotic emerging viral diseases: progress and challenges. Nat. Med. 10:S110S121.
14. Groen, J.,, B. G. van den Hoogen,, C. P. Burghoorn-Maas,, A. R. Fooks,, J. Burton,, C. J. Clegg,, H. Zeller, and , A. D. Osterhaus. 2003. Serological reactivity of baculovirus-expressed Ebola virus VP35 and nucleoproteins. Microbes Infect. 5:379385.
15. Ikegami, T.,, M. Saijo,, M. Niikura,, M. E. Miranda,, A. B. Calaor,, M. Hernandez,, D. L. Manalo,, I. Kurane,, Y. Yoshikawa, and , S. Morikawa. 2002. Development of an immunofluorescence method for the detection of antibodies to Ebola virus subtype Reston by the use of recombinant nucleoprotein-expressing HeLa cells. Microbiol. Immunol. 46:3338.
16. Ikegami, T.,, M. Niikura,, M. Saijo,, M. E. Miranda,, A. B. Calaor,, M. Hernandez,, L. P. Acosta,, D. L. Manalo,, I. Kurane,, Y. Yoshikawa, and , S. Morikawa. 2003. Antigen capture enzyme-linked immunosorbent assay for specific detection of Reston Ebola virus nucleoprotein. Clin. Diagn. Lab. Immunol. 10:552557.
17. Ikegami, T.,, M. Saijo,, M. Niikura,, M. F. Miranda,, A. B. Calaor,, M. Hernandez,, D. L. Manalo,, I. Kurane,, Y. Yoshikawa, and , S. Morikawa. 2003. Immunoglobulin G enzyme-linked immunosorbent assay using truncated nucleoproteins of Reston Ebola virus. Epidemiol. Infect. 130:533539.
18. Jahrling, P. B.,, T. W. Geisbert,, N. K. Jaax,, M. A. Hanes,, T. G. Ksiazek, and , C. J. Peters. 1996. Experimental infection of cynomolgus macaques with Ebola-Reston filoviruses from the 1989-1990 U.S. epizootic. Arch. Virol. Suppl. 11:115134.
19. Johnson, K. M. L.,, L. Elliott, and , D. L. Heymann. 1981. Preparation of polyvalent viral immunofluorescent intracel-lular antigens and use in human serosurveys. J. Clin. Microbiol. 14:527529.
20. Ksiazek, T. G.,, P. F. Rollin,, P. B. Jahrling,, E. Johnson,, D. W. Dalgard, and , C. J. Peters. 1992. Enzyme immunosorbent assay for Ebola virus antigens in tissues of infected primates. J. Clin. Microbiol. 30:947950.
21. Ksiazek, T. G.,, C. P. West,, P. F. Rollin,, P. B. Jahrling, and , C. J. Peters. 1999. ELISA for the detection of antibodies to Ebola viruses. J. Infect. Dis. 179:S192S198.
22. Lozana, M. E.,, P. D. Ghiringhelli,, V. Romanowski, and , O. Grau. 1993. A simple nucleic acid amplification assay for the rapid detection of Junin virus in whole blood samples. Virus Res. 27:3753.
23. Lucht, A.,, R. Grunow,, C. Otterbein,, P. Moller,, H. Feldmann, and , S. Becker. 2004. Production of monoclonal antibodies and development of an antigen capture ELISA directed against the envelope glycoprotein GP of Ebola virus. Med. Microbiol. Immunol. 193:181187.
24. Morales, M. A.,, G. E. Calderon,, L. M. Riera,, A. M. Ambrosio,, D. A. Enria, and , M. S. Sabattini. 2002. Evaluation of an enzyme-linked immunosorbent assay for detection of antibodies to Junin virus in rodents. J. Virol. Methods 103:5766.
25. Niedrig, M.,, H. Schmitz,, S. Becker,, S. Gunther,, J. ter Meulen,, H. Meyer,, H. Ellerbrok,, A. Nitsche,, H. R. Gelderblom, and , C. Drosten. 2004. First international quality assurance study on the rapid detection of viral agents of bioterrorism. J. Clin. Microbiol. 42:17531755.
26. Niikura, M.,, T. Ikegami,, M. Saijo,, I. Kurane,, M. F. Miranda, and , S. Morikawa. 2001. Detection of Ebola viral antigen by enzyme-linked immunosorbent assay using a novel monoclonal antibody to nucleoprotein. J. Clin. Microbiol. 39:32673271.
27. Niklasson, B. S.,, P. B. Jahrling, and , C. J. Peters. 1984. Detection of Lassa virus antigens and Lassa-specific IgG and IgM by enzyme-linked immunosorbent assay. J. Clin. Microbiol. 20:239244.
28. Peters, C. J.,, R. B. Jahrling, and , A. Khan. 1996. Patients infected with high-hazard viruses: scientific basis for infection control. Arch. Virol. Suppl. 11:141168.
29. Peters, C. J., and , J. W. LeDuc. 1999. An introduction to Ebola: the virus and the disease. J. Infect. Dis. 179:S1S288.
30. Peters, C. J. 2002. Human infection with arenaviruses in the Americas. Curr. Top. Microbiol. Immunol. 262:6574.
31. Rollin, P. E.,, T. G. Ksiazek,, P. B. Jahrling,, M. Haines, and , C. J. Peters. 1990. Direct detection of Ebola-like viruses by immunofluorescence (IF) in impression smears from macaque tissues. Lancet 336:1591.
32. Salvato, M. S.,, J. C. S. Clegg,, M. J. Buchmeier,, R. N. Charrel,, J. P. Gonzalez,, I. S. Lukashevich,, C. J. Peters,, R. Rico-Hesse, and , V. Romanowski. 2004. Arenaviridae, p. 725733. In C. M. Fauquet,, M. A. Mayo,, J. Maniloff,, U. Desselberger, and , L. A. Ball (ed.), Virus Taxonomy, VIIIth Report of the ICTV Elsevier/Academic Press, London, United Kingdom.
33. Sanchez, A.,, A. Khan,, S. Zaki,, G. Nabel,, T. Ksiazek, and , C. J. Peters. 2001. “Filoviridae” Marburg and Ebola viruses, p. 12791304. In D. M. Knipe and , P. M. Howley (ed.), Fields Virology, 4th ed., vol. 1. Lippincott Williams & Wilkins, Philadelphia, Pa.
34. Towner, J. S.,, P. F. Rollin,, D. G. Bausch,, A. Sanchez,, S. M. Crary,, M. Vincent,, W. F. Lee,, C. F. Spiropoulou,, T. G. Ksiazek,, M. Lukwiya,, F. Kaducu,, R. Downing, and , S. T. Nichol. 2004. Rapid diagnosis of Ebola hemorrhagic fever by reverse transcription-PCR in an outbreak setting and assessment of patient viral load as a predictor of outcome. J. Virol. 78:43304341.
35. Trappier, S. G.,, A. L. Conaty,, B. B. Farrar,, D. D. Auperin,, J. B. McCormick, and , S. P. Fisher-Hoch. 1993. Evaluation of the polymerase chain reaction for diagnosis of Lassa virus infection. Am. J. Trop. Med. Hyg. 49:214221.
36. Vainrub, B., and , R. Salas. 1994. Latin American hemorrhagic fever. Infect. Dis. Clin. North Am. 8:4759.
37. Zaki, S. R.,, W. J. Shieh,, P. W. Greer,, C. S. Goldsmith,, T. Ferebee,, J. Katshitshi,, F. K. Tshioko,, M. A. Bwaka,, R. Swanepoel,, P. Calain,, A. S. Khan,, E. Lloyd,, P. E. Rollin,, T. G. Ksiazek,, C. J. Peters, and Commission de Lutte contre les Epidemies a Kikwit. 1999. A novel immunohistochemical assay for the detection of Ebola virus in skin: implications for diagnosis, spread, and surveillance of Ebola hemorrhagic fever. J. Infect. Dis. 179:S36S47.

Tables

Generic image for table
TABLE 1

Characteristics of arenaviruses

Citation: Strong J, Grolla A, Jahrling P, Feldmann H. 2006. Filoviruses and Arenaviruses, p 774-790. In Detrick B, Hamilton R, Folds J (ed), Manual of Molecular and Clinical Laboratory Immunology, 7th Edition. ASM Press, Washington, DC. doi: 10.1128/9781555815905.ch87
Generic image for table
TABLE 2

International High Security Laboratory Network (IHSLN) list of members

Citation: Strong J, Grolla A, Jahrling P, Feldmann H. 2006. Filoviruses and Arenaviruses, p 774-790. In Detrick B, Hamilton R, Folds J (ed), Manual of Molecular and Clinical Laboratory Immunology, 7th Edition. ASM Press, Washington, DC. doi: 10.1128/9781555815905.ch87
Generic image for table
TABLE 3

Laboratory diagnosis

Citation: Strong J, Grolla A, Jahrling P, Feldmann H. 2006. Filoviruses and Arenaviruses, p 774-790. In Detrick B, Hamilton R, Folds J (ed), Manual of Molecular and Clinical Laboratory Immunology, 7th Edition. ASM Press, Washington, DC. doi: 10.1128/9781555815905.ch87

This is a required field
Please enter a valid email address
Please check the format of the address you have entered.
Approval was a Success
Invalid data
An Error Occurred
Approval was partially successful, following selected items could not be processed due to error